manR [2019-06-25 11:19:21]

transcriptional activator of the manP-manA-yjdF operon

Locus: BSU12000

Isoelectric point: 8.04

Molecular weight: 75.13 kDa

Protein length: 648 aa

Gene length: 1947 bp

Function: regulation of mannose utilization

Product: transcriptional activator, PRD-type

Essential: no

Synonyms: yjdC

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of mannose
• Information processing → Regulation of gene expression → Transcription factors and their control → PRD-type regulators
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 1,270,631 → 1,272,577

The protein

Protein family

• PRD-containing transcriptional activator

Modification

• phosphorylation by ManP inactivates ManR (in the absence of mannose), phosphorylation by HPr stimluates ManR PubMed

Expression and Regulation

Operons

• Genes: manR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • ManR: activation, in the presence of mannose and absence of glucose PubMed, in ManR regulon
  • CcpA: repression, PubMed, in CcpA regulon

  Regulation

  • induced by mannose (ManR) PubMed

Biological materials

Mutant

• MGNA-A269 (yjdC::erm), available at the NBRP B. subtilis, Japan
• BKE12000 (ΔmanR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT
• BKK12000 (ΔmanR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTTTTTCTATCCTTC, downstream forward: _UP4_TAAAAGCAGGGATTATTCCT

References

Loading